This page has been archived and is no longer updated
Quantitative mapping of amplicon structure by array CGH identifies CYP24 as a candidate oncogene.
Author: Albertson, D. G.
Keywords
Keywords for this Article
Add keywords to your Content
Save
|
Cancel
Share
|
Cancel
Revoke
|
Cancel
Rate & Certify
Rate Me...
Rate Me
!
Comment
Save
|
Cancel
Flag Inappropriate
The Content is
Objectionable
Explicit
Offensive
Inaccurate
Comment
Flag Content
|
Cancel
Delete Content
Reason
Delete
|
Cancel
Close
Full Screen
"W e show here that quantitative measurement of DNA copy num- ber across amplified regions using array comparative genomic hybridization 1?4 (CGH) may facilitate oncogene identifica- tion by providing precise information on the locations of both amplicon boundaries and amplification maxima. Using this ana- lytical capability, we resolved two regions of amplification within an approximately 2-Mb region of recurrent aberration at 20q13.2 in breast cancer. The putative oncogene ZNF217 (ref. 5) mapped to one peak, and CYP24 (encoding vitamin D 24 hydroxylase), whose overexpression is likely to lead to abrogation of growth con- trol mediated by vitamin D (ref. 6), mapped to the other. Positional localization of candidate oncogenes often includes assembly of a contig of large-insert genomic clones, such as BACs, across the region. We have shown previously that such clone sets can be used as probes to map the boundaries of chromosomal rearrangements by fluo- rescent in situ hybridization (FISH) with a finer resolution than the insert size of the clones 7,8 . Here we report that similar sub-clonal resolution mapping of varia- Quantitative mapping of amplicon structure by array CGH identifies CYP24 as a candidate oncogene brief communications 144 nature genetics ? volume 25 ? june 2000 Although the scope of our study has been limited by the restricted supply of suitable human tissues, our results suggest that somatic mutation of PKD1 may be a modifier of disease severity in ADPKD2. We speculate that trans-heterozygous loss of function at the somatic level may be sufficient to disrupt the signalling pathway in which these proteins participate. Acknowledgements We thank the individuals with ADPKD and their families for participation. This work was supported by the NIH (DK48006, DK02562), the Polycystic Kidney Disease Research Foundation and the Kidney Foundation of Canada. G.G.G. is the Irving Blum Scholar of the Johns Hopkins University School of Medicine. Terry Watnick 1 *, Ning He 2 *, Kairong Wang 2 , Yan Liang 3 , Patrick Parfrey 4 , Donna Hefferton 4 , Peter St George- Hyslop 3 , Gregory Germino 1 & York Pei 2 *These authors contributed equally to this work. 1 Department of Medicine, Division of Nephrology, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA. 2 Department of Medicine, University Health Network, Toronto, Ontario, Canada. 3 Tanz Research Institute, Toronto, Ontario, Canada. 4 Division of Nephrology, Department of Medicine, Health Sciences Center, St Johns, Newfoundland, Canada. Correspondence should be addressed to G.G. (e-mail: ggermino@welch. jhu.edu) or Y.P. (York.Pei@uhn.on.can). 1. Qian, F., Watnick, T.J., Onuchic, L.F. & Germino, G.G. Cell 87, 979?987 (1996). 2. Watnick, T.J. et al. Mol. Cell 2, 247?251 (1998). 3. Koptides, M., Hadjimichael, C., Koupepidou, P., Pierides, A. & Deltas, C.C. Hum. Mol. Genet. 8, 509?513 (1999). 4. Pei, Y. et al. J. Am. Soc. Nephrol. 10, 1524?1529 (1999). 5. Lu, W. et al. Nature Genet. 17, 179?181 (1997). 6. Wu, G. et al. Cell 93, 177?188 (1998). 7. Geng, L. et al. J. Clin. Invest. 98, 2674?2682 (1996). 8. Ong, A.C. et al. Am. J. Pathol. 154, 1721?1729 (1999). 9. Ong, A.C. & Harris, P.C. Lancet 349, 1039?1040 (1997). 10. Pei, Y. et al. J. Am. Soc. Nephrol. 9, 1852?1860 (1998). 11. Torra, R. et al. Kidney Int. 56, 28?33 (1999). 12. Qian, F. et al. Nature Genet. 16, 179?183 (1997). 13. Watnick, T.J. et al. Hum. Mol. Genet. 6, 1473?1481 (1997). 14. Watnick, T.J. et al. Am. J. Hum. Genet. 65, 1561?1571 (1999). 15. Koptides, M., Mean, R., Demetriou, K., Pierides, A. & Deltas, C.C. Hum. Mol. Genet. 12, 447?452 (2000). Fig. 1 Somatic mutations of PKD1 in PKD2 cysts. a, SSCP analysis of the C5383T SNP in exon 15. A duplex pattern is seen in all samples except C15. C15 also had LOH at another SNP locus in exon 13 (T3274C; data not shown; ref. 14). b, Confirmation of LOH by restriction digestion. The C5383T poly- morphism (P) results in the loss of an HaeIII site and creation of a new 203-bp fragment. C15 lacks the 203-bp band compared with a control cyst (C16). c, SSCP analysis of the T7376C SNP in exon 17 of UT1270. The SSCP pattern for individuals homozygous for each allele are included (A, B; refs 2,14). All cysts have both alleles, except C32, which has only B (32-1). This result was confirmed using a second, independently amplified long-range PCR product (32-2). C15, which exhibited LOH for markers in exon 15 (a), is heterozygous for this marker. d, Confirmation of LOH in exon 17 by restriction digestion. The T7376C substitution cre- ates a new MvaII site in A (present in the control cyst, C21), which is lost in C32-1 and C32-2. U, uncut product; M, 1-kb ladder. e, C9 from UT1500 has a 2-bp substitution (G1501T, C1502T; blue box) that results in a premature stop codon (red box). The exon 6 SSCP pattern for four cysts of UT1500 is shown, and the arrow identifies a variant seen in two independent PCR reactions from C9 (9-1, 9-2). The sequence tracings for normal and variant bands are shown in the 3�-5� direction. The com- plementary sequence is also given with the pre- dicted peptide sequence. Methods for PKD1 mutation detection have been described 2,13,14 . a b c d e cyst 9 control � 2000 Nature America Inc. ? http://genetics.nature.com � 2000 Nature America Inc. ? http://g enetics.nature .com brief communications nature genetics ? volume 25 ? june 2000 145 tions in DNA copy number can be per- formed on sets of overlapping clones using array CGH. In array CGH (refs 1?4), total genomic DNA from a tumour and a normal cell population are labelled with different fluorochromes and hybridized to arrayed clones. The ratio of the fluorescence intensities on each spot in the array is then proportional to the copy number of the corresponding sequences in the tumour. As the ratio on a clone represents the average DNA copy number over its length, comparison of ratios on overlapping clones should allow aberrations to be mapped to a fraction of the length of a clone. We demonstrated the biological value of this ?high-resolution? form of array CGH using an array comprised of over- lapping BAC and P1 clones (Fig. 1a) to map amplicon boundaries and copy- number profiles across a 2-Mb region of recurrent amplification at 20q13.2 in breast cancer. We found that most breast tumours and cell lines with amplification at 20q13.2 (refs 2,5, and unpublished data) showed elevated and slightly vary- ing copy number across the entire region (data not shown) clearly distinct from normal specimens (Fig. 1b). In three tumours, however, we observed a dra- matic variation in copy number across the region (Fig. 1c). The profiles showed narrow regions of copy-number maxima as well as amplicon boundaries that indi- cate two regions that may be indepen- dently amplified in breast tumours within this 2-Mb genomic segment. The peaks in the copy number profiles suggest that progressive ?trimming? of the amplified segment may have taken place in these tumours as copy number increased, a phenomenon that has been described in cultured cells under drug selection 9 . There is therefore an expectation that the ?driver? genes are located at these relatively narrow regions of highest copy number. The puta- tive oncogene ZNF217 (ref. 5) maps to the peak of the more proximal region (Fig. 1). CYP24 is located at the more distal region, and is thus a candidate ?driver? gene for it. CYP24 has not been previously implicated in breast cancer, but its known function supports its candidacy. CYP24 limits the biological activity of the vitamin D sig- nalling system 6,10,11 , so that overexpres- sion due to amplification may abrogate vitamin-D?mediated growth control. As transcription of CYP24 is closely coupled to the level and activity of the vitamin D 0.5 1 1.5 position 20q13.2 ZNF217 CYP24BCAS1 centromere telomere ZNF218 ZNF217 CYP24BCAS1 B4109 B4028 B4195 B4198 B4090 P4070 B4208 B4132 B4201B4166 P4030 dJ1191N16 P4041 B4121 B4188 P4067 P4007 P4016 B4123 B4103 B4130 P4185 B4099 P4018 B4087 P4010 ZNF218 P4039 P4009 B4097 position 20q13.2 centromere telomere normalized ratio D20S480 RMC20C001 D20S854 D20S183 WI-16697 D20S211 D20S876 D20S1044 WI-16748 D20S913 D20S720 afm22zd12 WI-9227 WI-19642 D20S120 D20S708E WI-11116E, WI-15702E STSG25428 D20S776D20S609D20S902 D20S1020 Fig. 1 Copy-number profiles for normal and tumour DNA samples on an array of clones from 20q13.2. a, BAC and P1 clone contig between D20S902 and D20S776 (ref. 5, and C.C. et al., manuscript in preparation). Information on clones reported previously may be obtained from refs 2,5. Additional P1 clones were selected from the Du Pont B library 14 and included RMC20P4009 (coordi- nates 35 F9) and RMCP4016 (coordinates 58 B9). Additional BAC clones obtained from the Research Genetics Human BAC libraries 15 included RMC20B4121 (CITB 10 C10), RMC20B4195 (CITB 10 E24), RMC20B4198 (CITB 222 D11), RMC20B4090 (CITB 51 B21), RMC20B4208 (RPCI-11 31D8), RMC20B4132 (CITB 262 J18) and RMC20B4201 (RPCI-11 168E12). The clone dJ1191N16 (RPCI-5 119N16) was obtained from the Sanger Centre. The lengths of the horizontal lines representing the clones are proportional to the clone sizes or STS content. Names are given above the line, omitting the RMC20 prefix. Selected STS markers are shown above the contig and their positions are indicated by vertical lines. The location of ZNF218, ZNF217, BCAS1 and CYP24 is indicated below the contig (arrowheads indicate transcriptional polarity, where known). b, Fluorescence ratios on the chromosome 20q13.2 array targets for three comparisons of a normal genome to itself. Fab- rication of arrays, comparative hybridizations, imaging and analysis were carried out as described 2 . Each array target clone is represented by a horizontal bar indicating the location and length of the clone as determined by STS content mapping. The vertical position indicates the measured ratio. The ratios were nor- malized so that the average for all targets in each hybridization was 1.0. The data points show the mean of the three normalized ratios obtained for each target, and the error bars indicate the standard deviations. The overall standard deviation for the measurements was 0.06. c, Copy-number profiles for three tumours (S50, S59 and S21) showing variation in copy number across the region. Ratios on clones from the contig (a) were normalized to the average of the ratios of six clones from chromosome 20p (ref. 2). The data have been plotted as in (b). The two regions of peak copy number are shaded. Steep copy-number transitions within RMC20B4198 occurred in two tumours, suggesting that the site may be particularly prone to rearrangement. The average coefficient of variation of the ratios was 14.5% for three separate hybridizations with S21 genomic DNA. position 20q13.2 0 ZNF217 BCAS1 CYP24 centromere telomere 14 0 2 4 6 8 10 12 S50 0 1 2 3 4 5 6 7 S59 2 4 6 8 10 12 14 S21 B4198 B4195 B4121 B4097 B4087 B4087 B4198 B4121 B4097 B4121 B4087 B4090 B4090 B4097 ZNF218 normalized ratio normalized ratio normalized ratio a b c � 2000 Nature America Inc. ? http://genetics.nature.com � 2000 Nature America Inc. ? http://g enetics.nature .com brief communications 146 nature genetics ? volume 25 ? june 2000 receptor 6 (VDR), we measured both CYP24 and VDR transcript levels using quantitative PCR. Expression of CYP24, normalized with respect to VDR, corre- lates with copy number of CYP24 in tumours (Fig. 2), further supporting an oncogenic role for CYP24. Our observations indicate that tumours may show peaks in the copy-number pro- file across an amplified region. Extrapola- tion from model systems suggests that the peaks contain genes that are selected dur- ing the amplification process. Both CYP24 and ZNF217 (ref. 5), two genes located at the amplification maxima at 20q13.2, show expression increases consistent with assign- ment as putative oncogenes. Furthermore, the function of CYP24 suggests the manner in which the gene contributes to oncogene- sis. Thus, the capability to identify peaks in copy-number profiles across regions of recurrent abnormality may be generally useful for localization of oncogenes. Our analysis also indicates that mapping ampli- con boundaries alone may provide mis- leading information on the location of critical genes when there are multiple, closely spaced amplicons. Poor prognosis 12 and aggressive clinical features 12,13 have been associated with increased copy num- ber at the RMC20C001 locus, which maps to the proximal end of the 20q13.2 contig (Fig. 1a). As this locus is not centred on either of the regions reported here, addi- tional studies will be required to determine the prevalence and possible specific pheno- typic consequences of these more precisely defined amplifications. Acknowledgements This work was supported by NIH grants CA80314, CA45919, HD17665 and P50 CA58207, California BCRP grant 2RB-0225 and Vysis. Donna G. Albertson 1,2 , Bauke Ylstra 1 , Richard Segraves 2 , Colin Collins 1,2 , Shanaz H. Dairkee 3 , David Kowbel 1 , Wen-Lin Kuo 2 , Joe W. Gray 2 & Daniel Pinkel 2 1 Cancer Research Institute, University of California, San Francisco, Box 0808, San Francisco, California, USA. 2 Cancer Genetics and Breast Oncology Programs, UCSF Cancer Center, University of California, San Francisco, Box 0808, San Francisco, California, USA. 3 Geraldine Brush Cancer Research Institute, California Pacific Medical Center, San Francisco, California, USA. Correspondence should be addressed to D.G.A. (e-mail: albertson@cc.ucsf.edu). 1. Solinas-Toldo, S. et al. Genes Chromosomes Cancer 20, 399?407 (1997). 2. Pinkel, D. et al. Nature Genet. 20, 207?211 (1997). 3. Geschwind, D.H. et al. Dev. Genet. 23, 215?229 (1998). 4. Pollack, J.R. et al. Nature Genet. 23, 41?46 (1999). 5. Collins, C. et al. Proc. Natl Acad. Sci. USA 95, 8703?8708 (1998). 6. Walters, M.R. Endocr. Rev. 13, 719?764 (1992). 7. Albertson, D.G. Genetics 134, 211?219 (1993). 8. Albertson, D.G., Fishpool, R.M. & Birchall, P.S. Caenorhabditis elegans: Modern Biological Analysis of an Organism 339?364 (Academic, New York, 1995). 9. Brodeur, G.M. & Hogarty, M.D. The Genetic Basis of Human Cancer 161?172 (McGraw-Hill, New York, 1998). 10. John, E.M., Schwartz, G.G., Dreon, D.M. & Koo, J. Cancer Epidemiol. Biomarkers Prev. 8, 399?406 (1999). 11. Alini, M., Marriott, A., Chen, T., Abe, S. & Poole, A.R. Dev. Biol. 176, 124?132 (1996). 12. Tanner, M.M. et al. Clin. Cancer Res. 1, 1455?1461 (1995). 13. Courjal, F. et al. Cancer Res. 57, 4360?4367 (1997). 14. Shepherd, N.S. et al. Proc. Natl Acad. Sci. USA 91, 2629?2633 (1994). 15. Kim, U.J. et al. Proc. Natl Acad. Sci. USA 93, 6297?6301 (1996). 0.01 0.1 1 S50 S59 S21 tumour 2 13 36 relative expression Fig. 2 Relative expression of CYP24 in breast tumours. Transcript levels of CYP24 and VDR in RNA from frozen breast tumour sections were measured by quantitative RT?PCR. Amplification reactions were performed in triplicate on three different concentrations of each tumour RNA. A 71-bp fragment starting at position 783 in the CYP24 mRNA sequence (GenBank accession no. NM 000782) was amplified using forward primer 5�?CAAACCGTGGAAGGCCTATC?3� and reverse primer 5�?AGTCTTCCCCTTCCAGGATCA?3�. A TaqMan probe (5�?FAM (6-carboxy-fluorescein)-ACTACCGCAAAGAAGGCTACGGGCTG?3� TAMRA (6-carboxy-tetramethyl- rhodamine)) was included in the reaction. An 81-bp fragment starting at position 246 in the VDR mRNA sequence (GenBank accession no. NM 000376) was amplified using forward primer 5�?CTTCAGGCGAAGCAT- GAAGC?3� and reverse primer 5�?CCTTCATCATGCCGATGTCC?3�. A TaqMan probe (5�?FAM-AAGGCAC- TATTCACCTGCCCCTTCAA?3� TAMRA) was included. The data are plotted as 2 -D N? SD , where D N is the difference in the number of cycles needed for the fluorescence intensity for each gene to reach a threshold value. Copy number of the CYP24 locus in each tumour is shown and was calculated from the array CGH ratios and the number of copies of 20p, as determined by FISH. Relative levels of CYP24 were higher in the tumours with amplification at the CYP24 locus and highest in the most highly amplified tumour, S21. � 2000 Nature America Inc. ? http://genetics.nature.com � 2000 Nature America Inc. ? http://g enetics.nature .com "
Add Content to Group
|
Bookmark
|
Keywords
|
Flag Inappropriate
share
Close
Digg
Facebook
MySpace
Google+
Comments
Close
Please Post Your Comment
*
The Comment you have entered exceeds the maximum length.
Submit
|
Cancel
*
Required
Comments
Please Post Your Comment
No comments yet.
Save Note
Note
View
Public
Private
Friends & Groups
Friends
Groups
Save
|
Cancel
|
Delete
Please provide your notes.
Next
|
Prev
|
Close
|
Edit
|
Delete
Genetics
Gene Inheritance and Transmission
Gene Expression and Regulation
Nucleic Acid Structure and Function
Chromosomes and Cytogenetics
Evolutionary Genetics
Population and Quantitative Genetics
Genomics
Genes and Disease
Genetics and Society
Cell Biology
Cell Origins and Metabolism
Proteins and Gene Expression
Subcellular Compartments
Cell Communication
Cell Cycle and Cell Division
Scientific Communication
Career Planning
Loading ...
Scitable Chat
Register
|
Sign In
Visual Browse
Close
Comments
CloseComments
Please Post Your Comment